Browse by author
Lookup NU author(s): Dr Emma Meczes, Ali Azim-Araghi, Dr Michael Tilby
Full text for this publication is not currently held within this repository. Alternative links are provided below where available.
Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence. © 2005 Elsevier Inc. All rights reserved.
Author(s): Meczes, E., Azim-Araghi, A., Ottley, C., Pearson, D.G., Tilby, M.J.
Publication type: Article
Publication status: Published
Journal: Biochemical Pharmacology
Year: 2005
Volume: 70
Issue: 12
Pages: 1717-1725
Print publication date: 05/12/2005
ISSN (print): 0006-2952
ISSN (electronic): 1873-2968
URL: http://dx.doi.org/10.1016/j.bcp.2005.09.025
DOI: 10.1016/j.bcp.2005.09.025
PubMed id: 16259963
Altmetrics provided by Altmetric
